Reading and writing gzipped files in Python

I've been reading in zipped (.gz) files (in my case, zipped fastq files of sequence data) in Python using a lovely Python module called gzip.py.
The same module can also write out zipped (.gz) files.

For example, here is a little script that reads in a zipped (.gz) input fastq file of sequence reads, and splits it into smaller files that have seqs_per_output_file sequences each. The output files are written out as zipped files (.gz).

I've highlighted the lines of the file that use the gzip module, and read and write from the input and output files.

Very handy!

import sys
import os
import gzip
from collections import defaultdict

#====================================================================#

# now read in the input fastq and split it up:    

def read_fastq_file_and_split(input_fastq_file, seqs_per_output_file, output_file_prefix):

    # open an output file:
    output_file_cnt = 1
    output_file = "%s_%d.fastq.gz" % (output_file_prefix, output_file_cnt)
    outputfileObj = gzip.open(output_file, "wb") # write out the output file in gzipped format
    print("Opening",output_file,"...")

    # read in the input file:
    fileObj = gzip.open(input_fastq_file, "rt") # this opens a gzipped file in text mode
    seqcnt = 0
    linecnt = 0
    for line in fileObj:
        line = line.rstrip()
        if line.startswith('@') and (linecnt == 0 or linecnt == 4):
            linecnt = 0
            seqcnt += 1
            if seqcnt == (seqs_per_output_file + 1):
                outputfileObj.close()
                output_file_cnt += 1
                output_file = "%s_%d.fastq" % (output_file_prefix, output_file_cnt)
                outputfileObj = gzip.open(output_file, "wb") # write out the output file in gzipped format
                print("Opening",output_file,"...")
                seqcnt = 1
        outputline = "%s\n" % line
        outputfileObj.write(outputline.encode()) # need to write bytes (not a string) to the output file, see https://stackoverflow.com/questions/49286135/write-strings-to-gzip-file
        linecnt += 1
    fileObj.close()
    outputfileObj.close()

    # the fastq file looks like this:
    # @M03558:259:000000000-BH588:1:1101:15455:1333 2:N:0:NTTGTA
    # NCAAGCATCTCATTTTGTGCATATACCTGGTCTTTCGTCTTCTGGCGTGAAGTCGCCGACTGAATGCCAGCAATCTCTTTTTGAGTCTCATTTTGCATCTCGGCAATCTCTTTCTGATTGTCCAGTTGCATTTTAGTAAGCTCTTTTTGATTCTCAAATCCGGCGTCAACCATACCAGCAGAGGAAGCATCAGCACCAGCACGCTCCCAAGCATTAAGCTCAGGAAATGCAGCAGCAAGATAATCACGAGT
    # +
    # #>>ABBFFFFFFGGGGGGGGGGHHHHHHHHHHHGHHGH2FFHHHHHGGGGGHHHGGGGGGGGHHHGHHHHGHHHHHHHHHHHGGGHHHHHHHHHHHHHHHHGGGGGHGFHHHHHHHHHHHHHGHHHHGHFHHHHHEFFFHGFFHHHHHGGHHHHHFGHHHHGGGCGGGFHHGGHGHHHHHHHHAGFFHHHHHGGGAEFHHHFDGDDGGGGEEBFGGGGGFGGGGEFGFFFGGGGGGFFFFFFBBFFFDFAA

    return

#====================================================================#

def main():
   
    # check the command-line arguments:
    if len(sys.argv) != 4 or os.path.exists(sys.argv[1]) == False:
        print("Usage: %s input_fastq_file seqs_per_output_file output_file_prefix" % sys.argv[0])
        sys.exit(1)
    input_fastq_file = sys.argv[1] # input fastq file                 
    seqs_per_output_file = int(sys.argv[2]) # number of sequences to put into each output file
    output_file_prefix = sys.argv[3] # prefix to use for the output file names

    # now read in the input fastq and split it up:    
    read_fastq_file_and_split(input_fastq_file, seqs_per_output_file, output_file_prefix)
   
#====================================================================#

if __name__=="__main__":
    main()

#====================================================================#