Phred quality scores are used as a measure of quality for DNA sequencing base quality.
I always forget how they are calculated.
From wikipedia, the Phred base quality score for a particular base is:
Q = -10 log_10 (P)
where P = the probability that a particular base was called incorrectly.
Working out the probability a particular base was called incorrectly from the Phred score?
If you have Q, you can work out P as:
P = 10^(-Q /10)
So a base quality score of 20 means P = 10^(-2) = 0.010.
A base quality score of 25 means P = 0.003 approx.
A base quality score of 30 means P = 0.001.
Working out the Phred quality score threshold needed to achieve a particular threshold of P
If we want to use a threshold of P = 0.05, then we would need to use a threshold of Q of:
Q = -10 log_10(0.05) = 13.0103.
Working back to get P gives:
P = 10^(-13.0103/10) = 0.05.
Likewise, for a threshold of P = 0.005:
Q = -10 log_10(0.005) = 23.0103.
Working back to get P gives:
P = 10^(-23.0103/10) = 0.005.
Monday, 29 October 2018
Friday, 26 October 2018
Running CRISPResso on a ton of sequencing data
I have a ton of sequencing data from an Illumina HiSeq lane from a PCR-amplicon sequence, and I'd like to run CRISPResso on it. In a previous blogpost, I talked about how to run CRISPResso.
Here's I'll talk about how to run it on loads of data! In this case I had ~20 million read-pairs for a single sample, while previously I had only run CRISPResso on 1-2 million read-pairs (even that took a couple of days!)
Here is a little plot I made of CRISPResso run-time in hours versus number of input read-pairs:
You can see that as the number of read-pairs gets above about 1 million, the run-time is 0.5-1 day roughly. I guess the runtime may also depend on things like the base quality of the reads (if they are low quality, I'm guessing CRISPResso will have to make lots of alignments with indels/substitutions, and may infer lots of indel/substitution mutations, which will take time).
To run CRISPResso on ~20 million read-pairs from a single sample, here's what I did:
1. Split up the input fastq files into smaller files of 1 million reads each
I have paired end read-pairs, so the input data is in a file called sample1_1.fastq.gz (forward reads) and sample1_2.fastq.gz (reverse reads). To split this up, I ran:
% python3 ~alc/Documents/git/Python/split_up_fastq.py sample1_1.fastq.gz 1000000 sample1_1_sub
% python3 ~alc/Documents/git/Python/split_up_fastq.py sample1_1.fastq.gz 1000000 sample1_1_sub
You can see my Python script on gist here.
Note to self: I submitted farm jobs to do this, as it's slow.
2. Use Trimmomatic to discard low quality read-pairs.
I used the Trimmomatic software to discard read-pairs with low quality bases, only taking read-pairs where both reads of a pair had average base quality of >=20. To do this, I ran:
% python3 ~alc/Documents/git/Python/filter_fastq_files_using_trimmomatic.py sample1 17
where here sample1 is the name of the sample in step 1 above, and 17 is the number of pairs of smaller fastq files that step 1 above made.
This script submits Trimmomatic jobs to the Sanger compute farm.
You can see my Python script on gist here.
3. Run CRISPResso on each smaller subset of read-pairs.
I then ran CRISPResso on each smaller subset of read-pairs:
% python3 ~alc/Documents/git/Python/submit_crispresso_jobs_for_subsetsoffastq.py sample1 17
where here sample1 is the name of the sample in step 1 above, and 17 is the number of pairs of smaller fastq files that step 1 above made.
This script submits CRISPResso jobs to the Sanger compute farm.
You can see my Python script on gist here, you would need to edit it at the 'xxx' positions, to put in your amplicon sequence, gRNA sequence and coding sequence.
Here's I'll talk about how to run it on loads of data! In this case I had ~20 million read-pairs for a single sample, while previously I had only run CRISPResso on 1-2 million read-pairs (even that took a couple of days!)
Here is a little plot I made of CRISPResso run-time in hours versus number of input read-pairs:
You can see that as the number of read-pairs gets above about 1 million, the run-time is 0.5-1 day roughly. I guess the runtime may also depend on things like the base quality of the reads (if they are low quality, I'm guessing CRISPResso will have to make lots of alignments with indels/substitutions, and may infer lots of indel/substitution mutations, which will take time).
To run CRISPResso on ~20 million read-pairs from a single sample, here's what I did:
1. Split up the input fastq files into smaller files of 1 million reads each
I have paired end read-pairs, so the input data is in a file called sample1_1.fastq.gz (forward reads) and sample1_2.fastq.gz (reverse reads). To split this up, I ran:
% python3 ~alc/Documents/git/Python/split_up_fastq.py sample1_1.fastq.gz 1000000 sample1_1_sub
% python3 ~alc/Documents/git/Python/split_up_fastq.py sample1_1.fastq.gz 1000000 sample1_1_sub
You can see my Python script on gist here.
Note to self: I submitted farm jobs to do this, as it's slow.
2. Use Trimmomatic to discard low quality read-pairs.
I used the Trimmomatic software to discard read-pairs with low quality bases, only taking read-pairs where both reads of a pair had average base quality of >=20. To do this, I ran:
% python3 ~alc/Documents/git/Python/filter_fastq_files_using_trimmomatic.py sample1 17
where here sample1 is the name of the sample in step 1 above, and 17 is the number of pairs of smaller fastq files that step 1 above made.
This script submits Trimmomatic jobs to the Sanger compute farm.
You can see my Python script on gist here.
3. Run CRISPResso on each smaller subset of read-pairs.
I then ran CRISPResso on each smaller subset of read-pairs:
% python3 ~alc/Documents/git/Python/submit_crispresso_jobs_for_subsetsoffastq.py sample1 17
where here sample1 is the name of the sample in step 1 above, and 17 is the number of pairs of smaller fastq files that step 1 above made.
This script submits CRISPResso jobs to the Sanger compute farm.
You can see my Python script on gist here, you would need to edit it at the 'xxx' positions, to put in your amplicon sequence, gRNA sequence and coding sequence.
Spiking sequencing libraries with PhiX
If you are sequencing a low complexity library (e.g. a PCR-amplicon library) using Illumina sequencers, it's a good idea to spike in some PhiX to improve base quality, as explained here and here on the Illumina support pages. On the seqanswers forum they say that PhiX is used for:
"introduction of sequencing diversity in low-complexity libraries (diversity is needed to discriminate clusters and create signal thresholds for base-calling). As the software has improved, the recommended amount of phiX spike-in has decreased."
Another comment says:
"Older basecalling software on the MiSeq used to require a 50% phiX spike for low-diversity (amplicon samples). More recently, the software has been updated and only requires a 5-10% spike."
"introduction of sequencing diversity in low-complexity libraries (diversity is needed to discriminate clusters and create signal thresholds for base-calling). As the software has improved, the recommended amount of phiX spike-in has decreased."
Another comment says:
"Older basecalling software on the MiSeq used to require a 50% phiX spike for low-diversity (amplicon samples). More recently, the software has been updated and only requires a 5-10% spike."
Reading and writing gzipped files in Python
I've been reading in zipped (.gz) files (in my case, zipped fastq files of sequence data) in Python using a lovely Python module called gzip.py.
The same module can also write out zipped (.gz) files.
For example, here is a little script that reads in a zipped (.gz) input fastq file of sequence reads, and splits it into smaller files that have seqs_per_output_file sequences each. The output files are written out as zipped files (.gz).
I've highlighted the lines of the file that use the gzip module, and read and write from the input and output files.
Very handy!
import sys
import os
import gzip
from collections import defaultdict
#====================================================================#
# now read in the input fastq and split it up:
def read_fastq_file_and_split(input_fastq_file, seqs_per_output_file, output_file_prefix):
# open an output file:
output_file_cnt = 1
output_file = "%s_%d.fastq.gz" % (output_file_prefix, output_file_cnt)
outputfileObj = gzip.open(output_file, "wb") # write out the output file in gzipped format
print("Opening",output_file,"...")
# read in the input file:
fileObj = gzip.open(input_fastq_file, "rt") # this opens a gzipped file in text mode
seqcnt = 0
linecnt = 0
for line in fileObj:
line = line.rstrip()
if line.startswith('@') and (linecnt == 0 or linecnt == 4):
linecnt = 0
seqcnt += 1
if seqcnt == (seqs_per_output_file + 1):
outputfileObj.close()
output_file_cnt += 1
output_file = "%s_%d.fastq" % (output_file_prefix, output_file_cnt)
outputfileObj = gzip.open(output_file, "wb") # write out the output file in gzipped format
print("Opening",output_file,"...")
seqcnt = 1
outputline = "%s\n" % line
outputfileObj.write(outputline.encode()) # need to write bytes (not a string) to the output file, see https://stackoverflow.com/questions/49286135/write-strings-to-gzip-file
linecnt += 1
fileObj.close()
outputfileObj.close()
# the fastq file looks like this:
# @M03558:259:000000000-BH588:1:1101:15455:1333 2:N:0:NTTGTA
# NCAAGCATCTCATTTTGTGCATATACCTGGTCTTTCGTCTTCTGGCGTGAAGTCGCCGACTGAATGCCAGCAATCTCTTTTTGAGTCTCATTTTGCATCTCGGCAATCTCTTTCTGATTGTCCAGTTGCATTTTAGTAAGCTCTTTTTGATTCTCAAATCCGGCGTCAACCATACCAGCAGAGGAAGCATCAGCACCAGCACGCTCCCAAGCATTAAGCTCAGGAAATGCAGCAGCAAGATAATCACGAGT
# +
# #>>ABBFFFFFFGGGGGGGGGGHHHHHHHHHHHGHHGH2FFHHHHHGGGGGHHHGGGGGGGGHHHGHHHHGHHHHHHHHHHHGGGHHHHHHHHHHHHHHHHGGGGGHGFHHHHHHHHHHHHHGHHHHGHFHHHHHEFFFHGFFHHHHHGGHHHHHFGHHHHGGGCGGGFHHGGHGHHHHHHHHAGFFHHHHHGGGAEFHHHFDGDDGGGGEEBFGGGGGFGGGGEFGFFFGGGGGGFFFFFFBBFFFDFAA
return
#====================================================================#
def main():
# check the command-line arguments:
if len(sys.argv) != 4 or os.path.exists(sys.argv[1]) == False:
print("Usage: %s input_fastq_file seqs_per_output_file output_file_prefix" % sys.argv[0])
sys.exit(1)
input_fastq_file = sys.argv[1] # input fastq file
seqs_per_output_file = int(sys.argv[2]) # number of sequences to put into each output file
output_file_prefix = sys.argv[3] # prefix to use for the output file names
# now read in the input fastq and split it up:
read_fastq_file_and_split(input_fastq_file, seqs_per_output_file, output_file_prefix)
#====================================================================#
if __name__=="__main__":
main()
#====================================================================#
The same module can also write out zipped (.gz) files.
For example, here is a little script that reads in a zipped (.gz) input fastq file of sequence reads, and splits it into smaller files that have seqs_per_output_file sequences each. The output files are written out as zipped files (.gz).
I've highlighted the lines of the file that use the gzip module, and read and write from the input and output files.
Very handy!
import sys
import os
import gzip
from collections import defaultdict
#====================================================================#
# now read in the input fastq and split it up:
def read_fastq_file_and_split(input_fastq_file, seqs_per_output_file, output_file_prefix):
# open an output file:
output_file_cnt = 1
output_file = "%s_%d.fastq.gz" % (output_file_prefix, output_file_cnt)
outputfileObj = gzip.open(output_file, "wb") # write out the output file in gzipped format
print("Opening",output_file,"...")
# read in the input file:
fileObj = gzip.open(input_fastq_file, "rt") # this opens a gzipped file in text mode
seqcnt = 0
linecnt = 0
for line in fileObj:
line = line.rstrip()
if line.startswith('@') and (linecnt == 0 or linecnt == 4):
linecnt = 0
seqcnt += 1
if seqcnt == (seqs_per_output_file + 1):
outputfileObj.close()
output_file_cnt += 1
output_file = "%s_%d.fastq" % (output_file_prefix, output_file_cnt)
outputfileObj = gzip.open(output_file, "wb") # write out the output file in gzipped format
print("Opening",output_file,"...")
seqcnt = 1
outputline = "%s\n" % line
outputfileObj.write(outputline.encode()) # need to write bytes (not a string) to the output file, see https://stackoverflow.com/questions/49286135/write-strings-to-gzip-file
linecnt += 1
fileObj.close()
outputfileObj.close()
# the fastq file looks like this:
# @M03558:259:000000000-BH588:1:1101:15455:1333 2:N:0:NTTGTA
# NCAAGCATCTCATTTTGTGCATATACCTGGTCTTTCGTCTTCTGGCGTGAAGTCGCCGACTGAATGCCAGCAATCTCTTTTTGAGTCTCATTTTGCATCTCGGCAATCTCTTTCTGATTGTCCAGTTGCATTTTAGTAAGCTCTTTTTGATTCTCAAATCCGGCGTCAACCATACCAGCAGAGGAAGCATCAGCACCAGCACGCTCCCAAGCATTAAGCTCAGGAAATGCAGCAGCAAGATAATCACGAGT
# +
# #>>ABBFFFFFFGGGGGGGGGGHHHHHHHHHHHGHHGH2FFHHHHHGGGGGHHHGGGGGGGGHHHGHHHHGHHHHHHHHHHHGGGHHHHHHHHHHHHHHHHGGGGGHGFHHHHHHHHHHHHHGHHHHGHFHHHHHEFFFHGFFHHHHHGGHHHHHFGHHHHGGGCGGGFHHGGHGHHHHHHHHAGFFHHHHHGGGAEFHHHFDGDDGGGGEEBFGGGGGFGGGGEFGFFFGGGGGGFFFFFFBBFFFDFAA
return
#====================================================================#
def main():
# check the command-line arguments:
if len(sys.argv) != 4 or os.path.exists(sys.argv[1]) == False:
print("Usage: %s input_fastq_file seqs_per_output_file output_file_prefix" % sys.argv[0])
sys.exit(1)
input_fastq_file = sys.argv[1] # input fastq file
seqs_per_output_file = int(sys.argv[2]) # number of sequences to put into each output file
output_file_prefix = sys.argv[3] # prefix to use for the output file names
# now read in the input fastq and split it up:
read_fastq_file_and_split(input_fastq_file, seqs_per_output_file, output_file_prefix)
#====================================================================#
if __name__=="__main__":
main()
#====================================================================#
Thursday, 25 October 2018
Randomly sample from a fastq file
Sometimes I want to take a sneak peak at some sequencing data, which is given to me hot from the sequencing machines in the form of a pair of fastq files (paired end read-pairs: one fastq file for the forward reads and one for the reverse reads). I used to just take the first n (e.g. 250,000) read-pairs from the top of the fastq file, to have a look. However, as discussed on seqanswers here it's often the case that:
“SOLiD or Illumina output files have a pile of
rubbish at the start of the file from bad sequencing reads (the edges of chips
/ cells seem to be more prone to error), which heavily influences the results
gleaned from the first few reads.”
To get around this, they suggest you subsample randomly using HTSeq, and also point to a discussion here.Filter read-pairs by average base quality using Trimmomatic
I have a large amount of Illumina sequencing data (~17 million read-pairs) and, before running further analysis, want to filter the data by the average base quality, for example by discarding all read pairs that have average base quality of <=20. The format of my data is two fastq files for my paired Illumina read-pairs, one for forward reads and one for reverse reads.
From a discussion on seqanswers about filtering, I found that people suggested Trimmomatic.
Running Trimmomatic
I tried running Trimmomatic on some smaller files of 250,000 (0.25 million) read-pairs, using this command-line: (note to self: on the Sanger farm)
% java -Xmx128M -jar /software/pathogen/external/apps/usr/local/Trimmomatic-0.33/trimmomatic-0.33.jar PE -threads 1 -phred33 sample1topsmall_1.fastq.gz sample1topsmall_2.fastq.gz sample1topsmallout_1_paired.fastq.gz sample1topsmallout_1_unpaired.fastq.gz sample1topsmallout_2_paired.fastq.gz sample1topsmallout_2_unpaired.fastq.gz SLIDINGWINDOW:150:20
where:
PE means my reads are paired ends,
-threads 1 tells Trimmomatic to just use one thread (one CPU),
-phred33 tells Trimmomatic that the phred quality scores in my file use ASCII_BASE=33 (see here for an explanation), (note to self: I knew this from CRISPResso output)
sample1topsmall_1.fastq.gz sample1topsmall_2.fastq.gz are my input fastq files,
sample1topsmallout_1_paired.fastq.gz, sample1topsmallout_1_unpaired.fastq.gz, sample1topsmallout_2_paired.fastq.gz, sample1topsmallout_2_unpaired.fastq.gz are output files produced by Trimmomatic (two with reads where both reads of a pair pass the filter, two files with reads where just one read of a pair passes),
SLIDINGWINDOW:150:20 tells Trimmomatic to use a sliding window of 150 bp and take reads that have average base quality of >=20 in this window (note to self: my reads are 150 bp long).
Output from Trimmomatic
Trimmomatic ran really quickly! It gave some output like this:
Input Read Pairs: 250000 Both Surviving: 1619 (0.65%) Forward Only Surviving: 228797 (91.52%) Reverse Only Surviving: 604 (0.24%) Dropped: 18980 (7.59%)
TrimmomaticPE: Completed successfully
You can see here that my forward reads were much higher quality than my reverse reads, so few read-pairs survived where both reads of the pair passed the quality filter. The output files sample1topsmallout_1_paired.fastq.gz and sample1topsmallout_2_paired.fastq.gz have 1619 reads each as 1619 read-pairs passed.
Run-time and memory (RAM) required by Trimmomatic
I found Trimmomatic very fast. For 2.5 million read-pairs, it took about 2 minutes to run on the Sanger compute farm (using one CPU), and needed just ~80 Mbyte of memory (RAM).
From a discussion on seqanswers about filtering, I found that people suggested Trimmomatic.
Running Trimmomatic
I tried running Trimmomatic on some smaller files of 250,000 (0.25 million) read-pairs, using this command-line: (note to self: on the Sanger farm)
% java -Xmx128M -jar /software/pathogen/external/apps/usr/local/Trimmomatic-0.33/trimmomatic-0.33.jar PE -threads 1 -phred33 sample1topsmall_1.fastq.gz sample1topsmall_2.fastq.gz sample1topsmallout_1_paired.fastq.gz sample1topsmallout_1_unpaired.fastq.gz sample1topsmallout_2_paired.fastq.gz sample1topsmallout_2_unpaired.fastq.gz SLIDINGWINDOW:150:20
where:
PE means my reads are paired ends,
-threads 1 tells Trimmomatic to just use one thread (one CPU),
-phred33 tells Trimmomatic that the phred quality scores in my file use ASCII_BASE=33 (see here for an explanation), (note to self: I knew this from CRISPResso output)
sample1topsmall_1.fastq.gz sample1topsmall_2.fastq.gz are my input fastq files,
sample1topsmallout_1_paired.fastq.gz, sample1topsmallout_1_unpaired.fastq.gz, sample1topsmallout_2_paired.fastq.gz, sample1topsmallout_2_unpaired.fastq.gz are output files produced by Trimmomatic (two with reads where both reads of a pair pass the filter, two files with reads where just one read of a pair passes),
SLIDINGWINDOW:150:20 tells Trimmomatic to use a sliding window of 150 bp and take reads that have average base quality of >=20 in this window (note to self: my reads are 150 bp long).
Output from Trimmomatic
Trimmomatic ran really quickly! It gave some output like this:
Input Read Pairs: 250000 Both Surviving: 1619 (0.65%) Forward Only Surviving: 228797 (91.52%) Reverse Only Surviving: 604 (0.24%) Dropped: 18980 (7.59%)
TrimmomaticPE: Completed successfully
You can see here that my forward reads were much higher quality than my reverse reads, so few read-pairs survived where both reads of the pair passed the quality filter. The output files sample1topsmallout_1_paired.fastq.gz and sample1topsmallout_2_paired.fastq.gz have 1619 reads each as 1619 read-pairs passed.
Run-time and memory (RAM) required by Trimmomatic
I found Trimmomatic very fast. For 2.5 million read-pairs, it took about 2 minutes to run on the Sanger compute farm (using one CPU), and needed just ~80 Mbyte of memory (RAM).
Thursday, 18 October 2018
Submitting an assembly plus annotations to the ENA
I need to submit an assembly plus annotations for a parasitic worm (a multicellular eukaryote) to the ENA. Note: see my previous blogpost on preparing an EMBL file for the ENA.
To do this, I followed these steps:
Step 1: Upload my EMBL file (with genome assembly and annotation) to the ENA submission website
Note (later): I think that actually Step 1 is not necessary for submitting your EMBL file to the ENA, so you could skip directly to Step 2 here (if you have your EMBL file already; if you need to make your EMBL file see here, and if you need to register your sample and study with the ENA see here).
Once I had created an EMBL file with my genome assembly and annotation (see here), and had checked my study and sample had already been registered with the ENA (see here), I followed these steps:
1) I went to the ENA submission website, and signed in using the login and password given to me by my team (Note to self: asked Pathogen Informatics team for this).
2) I clicked on the 'New Submissions' tab at the top.
3) Then I selected 'Submit genome assemblies'.
4) At the bottom of the screen, it says the first step is to upload the data files into the "Webin upload area". I clicked on the 'upload data files' link.
5) This brought me to a page that says to look at http://ena-docs.readthedocs.io/en/latest/upload_01.html
6) I created a md5sum for my file by typing:
% md5sum my.embl.gz > my.embl.gz.md5
7) Following the instructions on the http://ena-docs.readthedocs.io/en/latest/upload_01.html page, I did the following to transfer my files using ftp, to the ENA's "Webin upload area":
The files that I transferred were zipped embl files (e.g. enterobius_vermicularis_new2.embl.gz and enterobius_vermicularis_new2.embl.md5.gz for a species Enterobius vermicularis).
Step 2: Make a "manifest" file for the EMBL file
To submit an EMBL file for example for a species Enterobius vermicularis, you need to make a 'manifest file' that contains the information on the assembly, e.g. enterobius_vermicularis.manifest. The manifest files are described here. For example, for my species Enterobius vermicularis, the manifest file looked like this: (tab separated)
STUDY PRJEB503
SAMPLE ERS076738
ASSEMBLYNAME E_vermicularis_Canary_Islands_0011_upd
COVERAGE 53
PROGRAM SGA, Velvet, SSpace, IMAGE, GapFiller, REAPR
PLATFORM Illumina
MINGAPLENGTH 1
MOLECULETYPE genomic DNA
FLATFILE enterobius_vermicularis_new2.embl.gz
Note: here the assembly name has had '_upd' appended to it, as it is an update of a previous one that was in the ENA.
Note: If your assembly is in chromosomes you also need a chromosome list file (see here) as well as a manifest file; this wasn't the case for me as I just had scaffolds in my assembly.
Note: to see the manifest file information for an assembly that has already been submitted to the ENA, you can log into the ENA submission website (see Step 1 above), and then type the analysis accession number (e.g. ERZ021218) in the search box 'Accession/Unique name' at the top right, and you will see the analysis pop up, then click 'Edit' on the right' and you will see a page with 'Edit details' pop up, and then click on 'Edit XML' on the top right and this should bring you to a page with the details that were in the manifest, which will look something like this (I've highlighted in red the info that was used in the manifest file above):
<?xml version="1.0" encoding="UTF-8"?><ANALYSIS_SET>
<ANALYSIS accession="ERZ021254" alias="E_vermicularis_Canary_Islands_0011" center_name="WTSI">
<IDENTIFIERS>
<PRIMARY_ID>ERZ021254</PRIMARY_ID>
<SUBMITTER_ID namespace="WTSI">E_vermicularis_Canary_Islands_0011</SUBMITTER_ID>
</IDENTIFIERS>
<TITLE>Genome sequence of Enterobius vermicularis</TITLE>
<DESCRIPTION>We have sequenced the genome of Enterobius vermicularis</DESCRIPTION>
<STUDY_REF accession="ERP006298">
<IDENTIFIERS>
<PRIMARY_ID>ERP006298</PRIMARY_ID>
<SECONDARY_ID>PRJEB503</SECONDARY_ID>
</IDENTIFIERS>
</STUDY_REF>
<SAMPLE_REF accession="ERS076738">
<IDENTIFIERS>
<PRIMARY_ID>ERS076738</PRIMARY_ID>
</IDENTIFIERS>
</SAMPLE_REF>
<ANALYSIS_TYPE>
<SEQUENCE_ASSEMBLY>
<NAME>E_vermicularis_Canary_Islands</NAME>
<PARTIAL>false</PARTIAL>
<COVERAGE>53</COVERAGE>
<PROGRAM>SGA, Velvet, SSpace, IMAGE, GapFiller, REAPR</PROGRAM>
<PLATFORM>Illumina</PLATFORM>
<MIN_GAP_LENGTH>1</MIN_GAP_LENGTH>
</SEQUENCE_ASSEMBLY>
</ANALYSIS_TYPE>
<FILES>
<FILE checksum="4bb219b0585c07e91ac57332288236b0" checksum_method="MD5" filename="ERZ021/ERZ021254/EVEC.v1.QC.fa_v4_submit.gz" filetype="fasta"/>
</FILES>
</ANALYSIS>
</ANALYSIS_SET>
Step 3: Use the webin java client to submit the EMBL file to the ENA
1) Download the latest version of the webin command line tool, as described here. This is called something like webin-cli-root-1.4.2.jar.
2) If Java is not installed on your laptop, you need to install it (see here ).
3) You should now run the webin client in the directory that has your manifest file and chromosome list file (if you have a chromosome list file; see Step 2 above), using the -validate and -test options. You need to run the webin client by typing something like this:
% java -jar webin-cli-root-1.4.2.jar
Here are the options you need: (something like this: you will need to change it for your directories, password, username, etc.)
% /software/bin/java -jar webin-cli-root-1.4.2.jar -context genome -username xxx -password xxx -manifest enterobius_vermicularis.manifest -inputdir . -outputdir ./evermicularis -validate -test
where -username and -password give your username and password for the ENA (used in Step 1),
-manifest gives the name of your manifest file (e.g. enterobius_vermicularis.manifest),
-inputdir gives the name of your input directory,
-outputdir gives the name of the directory where you want output to be put (Note: you seem to need this option for the webin client to run),
-validate runs the EMBL file validator,
-test means that this is just a test run that runs the validator and the files are not actually submitted.
It's a good idea to do this before you submit.
Note: you need to have the EMBL file mentioned in your manifest file in the input directory (inputdir), e.g. file enterobius_vermicularis_new2.embl.gz. Webin does not seem to look for it in the "Webin upload area" (see Step 1) - this is what I had initially assumed it does, but it seems that's not the case.
Note: On the Sanger farm head node, this java program needs more memory (RAM) than the default required so I needed to reserve some RAM by typing:
% /software/bin/java -Xmx128M -jar webin-cli-root-1.4.2.jar
If your EMBL file is very large, the Java program may need more memory (RAM) than is allowed on the Sanger farm login node, so you will need to submit this as a farm job.
I wasn't able to get webin running on the Sanger farm (either farm head node or other nodes), as I kept getting an error :
'ERROR: A server error occurred when checking application version. Connect to wwwdev.ebi.ac.uk:443 [wwwdev.ebi.ac.uk/193.62.197.11] failed: Connection timed out'
I tried a few different things: (i) using -Dhttps.proxyHost and -Dhttps.proxyPort options in webin (see here) when running webin, and (ii) setting the environmental variable http_proxy on the farm. However, this still didn't run for me. However, I found it ran on my Sanger Mac laptop, so that was fine.
4) Once the webin command in (3) above has run, it produces an output report file in a subdirectory 'validate', e.g. mcorti/genome/M_corti_Specht_Voge_0011_upd/validate/mesocestoides_corti_new2.embl.gz.report
If the 'validate' output report file is empty, then it has run fine with no errors.
There is also an output 'submit' directory, e.g. mcorti/genome/M_corti_Specht_Voge_0011_upd/submit that contains a file analysis.XML. That is, the 'submit' directory should have your analysis XML file, which is an XML version of your manifest (see Step 2 above).
If it doesn't pass the 'validate' step, then look in the 'genome' directory to see what error messages you got.
5) If (4) was all ok, now run the webin client with the -submit option instead of -validate, and without -test:
% /software/bin/java -jar webin-cli-root-1.4.2.jar -context genome -username xxx -password xxx -manifest enterobius_vermicularis.manifest -inputdir . -outputdir ./evermicularis -submit
6) Once your assembly has been submitted, it will go into a queue in the ENA to be imported into their database. Once this has been done (may take a little while if they have a lot of sequence data in the queue already), you will be sent the new ENA accession number for it.
Checking what happened to your assembly
If you don't hear back from the ENA about your assembly, you can log into https://www.ebi.ac.uk/ena/submit/webin/ with your webin account. Then, in the "Analysis process" tab, you can search for the accessions to see if they have failed. Usually if there is a failure, the error messages will be emailed to the email address associated with your webin account (Note to self: this is the pathogen informatics team for the webin account I used.)
To do this, I followed these steps:
Step 1: Upload my EMBL file (with genome assembly and annotation) to the ENA submission website
Note (later): I think that actually Step 1 is not necessary for submitting your EMBL file to the ENA, so you could skip directly to Step 2 here (if you have your EMBL file already; if you need to make your EMBL file see here, and if you need to register your sample and study with the ENA see here).
Once I had created an EMBL file with my genome assembly and annotation (see here), and had checked my study and sample had already been registered with the ENA (see here), I followed these steps:
1) I went to the ENA submission website, and signed in using the login and password given to me by my team (Note to self: asked Pathogen Informatics team for this).
2) I clicked on the 'New Submissions' tab at the top.
3) Then I selected 'Submit genome assemblies'.
4) At the bottom of the screen, it says the first step is to upload the data files into the "Webin upload area". I clicked on the 'upload data files' link.
5) This brought me to a page that says to look at http://ena-docs.readthedocs.io/en/latest/upload_01.html
6) I created a md5sum for my file by typing:
% md5sum my.embl.gz > my.embl.gz.md5
7) Following the instructions on the http://ena-docs.readthedocs.io/en/latest/upload_01.html page, I did the following to transfer my files using ftp, to the ENA's "Webin upload area":
% ftp webin.ebi.ac.uk [enter username and password]> bin> put my.embl> put my.embl.md5> byeThe files that I transferred were zipped embl files (e.g. enterobius_vermicularis_new2.embl.gz and enterobius_vermicularis_new2.embl.md5.gz for a species Enterobius vermicularis).
Step 2: Make a "manifest" file for the EMBL file
To submit an EMBL file for example for a species Enterobius vermicularis, you need to make a 'manifest file' that contains the information on the assembly, e.g. enterobius_vermicularis.manifest. The manifest files are described here. For example, for my species Enterobius vermicularis, the manifest file looked like this: (tab separated)
STUDY PRJEB503
SAMPLE ERS076738
ASSEMBLYNAME E_vermicularis_Canary_Islands_0011_upd
COVERAGE 53
PROGRAM SGA, Velvet, SSpace, IMAGE, GapFiller, REAPR
PLATFORM Illumina
MINGAPLENGTH 1
MOLECULETYPE genomic DNA
FLATFILE enterobius_vermicularis_new2.embl.gz
Note: here the assembly name has had '_upd' appended to it, as it is an update of a previous one that was in the ENA.
Note: If your assembly is in chromosomes you also need a chromosome list file (see here) as well as a manifest file; this wasn't the case for me as I just had scaffolds in my assembly.
Note: to see the manifest file information for an assembly that has already been submitted to the ENA, you can log into the ENA submission website (see Step 1 above), and then type the analysis accession number (e.g. ERZ021218) in the search box 'Accession/Unique name' at the top right, and you will see the analysis pop up, then click 'Edit' on the right' and you will see a page with 'Edit details' pop up, and then click on 'Edit XML' on the top right and this should bring you to a page with the details that were in the manifest, which will look something like this (I've highlighted in red the info that was used in the manifest file above):
<?xml version="1.0" encoding="UTF-8"?><ANALYSIS_SET>
<ANALYSIS accession="ERZ021254" alias="E_vermicularis_Canary_Islands_0011" center_name="WTSI">
<IDENTIFIERS>
<PRIMARY_ID>ERZ021254</PRIMARY_ID>
<SUBMITTER_ID namespace="WTSI">E_vermicularis_Canary_Islands_0011</SUBMITTER_ID>
</IDENTIFIERS>
<TITLE>Genome sequence of Enterobius vermicularis</TITLE>
<DESCRIPTION>We have sequenced the genome of Enterobius vermicularis</DESCRIPTION>
<STUDY_REF accession="ERP006298">
<IDENTIFIERS>
<PRIMARY_ID>ERP006298</PRIMARY_ID>
<SECONDARY_ID>PRJEB503</SECONDARY_ID>
</IDENTIFIERS>
</STUDY_REF>
<SAMPLE_REF accession="ERS076738">
<IDENTIFIERS>
<PRIMARY_ID>ERS076738</PRIMARY_ID>
</IDENTIFIERS>
</SAMPLE_REF>
<ANALYSIS_TYPE>
<SEQUENCE_ASSEMBLY>
<NAME>E_vermicularis_Canary_Islands</NAME>
<PARTIAL>false</PARTIAL>
<COVERAGE>53</COVERAGE>
<PROGRAM>SGA, Velvet, SSpace, IMAGE, GapFiller, REAPR</PROGRAM>
<PLATFORM>Illumina</PLATFORM>
<MIN_GAP_LENGTH>1</MIN_GAP_LENGTH>
</SEQUENCE_ASSEMBLY>
</ANALYSIS_TYPE>
<FILES>
<FILE checksum="4bb219b0585c07e91ac57332288236b0" checksum_method="MD5" filename="ERZ021/ERZ021254/EVEC.v1.QC.fa_v4_submit.gz" filetype="fasta"/>
</FILES>
</ANALYSIS>
</ANALYSIS_SET>
Step 3: Use the webin java client to submit the EMBL file to the ENA
1) Download the latest version of the webin command line tool, as described here. This is called something like webin-cli-root-1.4.2.jar.
2) If Java is not installed on your laptop, you need to install it (see here ).
3) You should now run the webin client in the directory that has your manifest file and chromosome list file (if you have a chromosome list file; see Step 2 above), using the -validate and -test options. You need to run the webin client by typing something like this:
% java -jar webin-cli-root-1.4.2.jar
Here are the options you need: (something like this: you will need to change it for your directories, password, username, etc.)
% /software/bin/java -jar webin-cli-root-1.4.2.jar -context genome -username xxx -password xxx -manifest enterobius_vermicularis.manifest -inputdir . -outputdir ./evermicularis -validate -test
where -username and -password give your username and password for the ENA (used in Step 1),
-manifest gives the name of your manifest file (e.g. enterobius_vermicularis.manifest),
-inputdir gives the name of your input directory,
-outputdir gives the name of the directory where you want output to be put (Note: you seem to need this option for the webin client to run),
-validate runs the EMBL file validator,
-test means that this is just a test run that runs the validator and the files are not actually submitted.
It's a good idea to do this before you submit.
Note: you need to have the EMBL file mentioned in your manifest file in the input directory (inputdir), e.g. file enterobius_vermicularis_new2.embl.gz. Webin does not seem to look for it in the "Webin upload area" (see Step 1) - this is what I had initially assumed it does, but it seems that's not the case.
Note: On the Sanger farm head node, this java program needs more memory (RAM) than the default required so I needed to reserve some RAM by typing:
% /software/bin/java -Xmx128M -jar webin-cli-root-1.4.2.jar
If your EMBL file is very large, the Java program may need more memory (RAM) than is allowed on the Sanger farm login node, so you will need to submit this as a farm job.
I wasn't able to get webin running on the Sanger farm (either farm head node or other nodes), as I kept getting an error :
'ERROR: A server error occurred when checking application version. Connect to wwwdev.ebi.ac.uk:443 [wwwdev.ebi.ac.uk/193.62.197.11] failed: Connection timed out'
I tried a few different things: (i) using -Dhttps.proxyHost and -Dhttps.proxyPort options in webin (see here) when running webin, and (ii) setting the environmental variable http_proxy on the farm. However, this still didn't run for me. However, I found it ran on my Sanger Mac laptop, so that was fine.
4) Once the webin command in (3) above has run, it produces an output report file in a subdirectory 'validate', e.g. mcorti/genome/M_corti_Specht_Voge_0011_upd/validate/mesocestoides_corti_new2.embl.gz.report
If the 'validate' output report file is empty, then it has run fine with no errors.
There is also an output 'submit' directory, e.g. mcorti/genome/M_corti_Specht_Voge_0011_upd/submit that contains a file analysis.XML. That is, the 'submit' directory should have your analysis XML file, which is an XML version of your manifest (see Step 2 above).
If it doesn't pass the 'validate' step, then look in the 'genome' directory to see what error messages you got.
5) If (4) was all ok, now run the webin client with the -submit option instead of -validate, and without -test:
% /software/bin/java -jar webin-cli-root-1.4.2.jar -context genome -username xxx -password xxx -manifest enterobius_vermicularis.manifest -inputdir . -outputdir ./evermicularis -submit
6) Once your assembly has been submitted, it will go into a queue in the ENA to be imported into their database. Once this has been done (may take a little while if they have a lot of sequence data in the queue already), you will be sent the new ENA accession number for it.
Checking what happened to your assembly
If you don't hear back from the ENA about your assembly, you can log into https://www.ebi.ac.uk/ena/submit/webin/ with your webin account. Then, in the "Analysis process" tab, you can search for the accessions to see if they have failed. Usually if there is a failure, the error messages will be emailed to the email address associated with your webin account (Note to self: this is the pathogen informatics team for the webin account I used.)
AcknowledgementsA big thank you to Dr Ana M. Cerdeño-Tárraga at the ENA for her help, and also to the Pathogen Informatics team (Dr Jacqui Keane, Sara Sjunnebo) at Sanger for some advice.
Subscribe to:
Posts (Atom)
